URL
https://opencores.org/ocsvn/openrisc/openrisc/trunk
Subversion Repositories openrisc
[/] [openrisc/] [trunk/] [gnu-dev/] [or1k-gcc/] [gcc/] [testsuite/] [go.test/] [test/] [bench/] [shootout/] [fasta.c] - Rev 811
Go to most recent revision | Compare with Previous | Blame | View Log
/* Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: * Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. * Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. * Neither the name of "The Computer Language Benchmarks Game" nor the name of "The Computer Language Shootout Benchmarks" nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. */ /* * http://shootout.alioth.debian.org/u32/program.php?test=fasta&lang=gcc&id=3 */ /* The Computer Language Benchmarks Game * http://shootout.alioth.debian.org/ * * contributed by Petr Prokhorenkov */ #include <stdio.h> #include <stdlib.h> #include <string.h> #ifndef fwrite_unlocked // not available on OS X #define fwrite_unlocked fwrite #define fputc_unlocked fputc #define fputs_unlocked fputs #endif #define ARRAY_SIZE(a) (sizeof(a)/sizeof(a[0])) #define unlikely(x) __builtin_expect((x), 0) #define IM 139968 #define IA 3877 #define IC 29573 #define LINE_LEN 60 #define LOOKUP_SIZE 4096 #define LOOKUP_SCALE ((float)(LOOKUP_SIZE - 1)) typedef unsigned random_t; void random_init(random_t *random) { *random = 42; } // Special version with result rescaled to LOOKUP_SCALE. static inline float random_next_lookup(random_t *random) { *random = (*random*IA + IC)%IM; return (*random)*(LOOKUP_SCALE/IM); } struct amino_acid { char sym; float prob; float cprob_lookup; }; void repeat(const char *alu, const char *title, int n) { int len = strlen(alu); char buffer[len + LINE_LEN]; int pos = 0; memcpy(buffer, alu, len); memcpy(buffer + len, alu, LINE_LEN); fputs_unlocked(title, stdout); while (n > 0) { int bytes = n > LINE_LEN ? LINE_LEN : n; fwrite_unlocked(buffer + pos, bytes, 1, stdout); pos += bytes; if (pos > len) { pos -= len; } fputc_unlocked('\n', stdout); n -= bytes; } } /* * Lookup table contains mapping from real values to cumulative * probabilities. Careful selection of table size allows lookup * virtually in constant time. * * All cumulative probabilities are rescaled to LOOKUP_SCALE, * this allows to save one multiplication operation on each iteration * in randomize(). */ void * fill_lookup(struct amino_acid **lookup, struct amino_acid *amino_acid, int amino_acid_size) { float p = 0; int i, j; for (i = 0; i < amino_acid_size; i++) { p += amino_acid[i].prob; amino_acid[i].cprob_lookup = p*LOOKUP_SCALE; } // Prevent rounding error. amino_acid[amino_acid_size - 1].cprob_lookup = LOOKUP_SIZE - 1; for (i = 0, j = 0; i < LOOKUP_SIZE; i++) { while (amino_acid[j].cprob_lookup < i) { j++; } lookup[i] = &amino_acid[j]; } return 0; } void randomize(struct amino_acid *amino_acid, int amino_acid_size, const char *title, int n, random_t *rand) { struct amino_acid *lookup[LOOKUP_SIZE]; char line_buffer[LINE_LEN + 1]; int i, j; line_buffer[LINE_LEN] = '\n'; fill_lookup(lookup, amino_acid, amino_acid_size); fputs_unlocked(title, stdout); for (i = 0, j = 0; i < n; i++, j++) { if (j == LINE_LEN) { fwrite_unlocked(line_buffer, LINE_LEN + 1, 1, stdout); j = 0; } float r = random_next_lookup(rand); struct amino_acid *u = lookup[(short)r]; while (unlikely(u->cprob_lookup < r)) { ++u; } line_buffer[j] = u->sym; } line_buffer[j] = '\n'; fwrite_unlocked(line_buffer, j + 1, 1, stdout); } struct amino_acid amino_acid[] = { { 'a', 0.27 }, { 'c', 0.12 }, { 'g', 0.12 }, { 't', 0.27 }, { 'B', 0.02 }, { 'D', 0.02 }, { 'H', 0.02 }, { 'K', 0.02 }, { 'M', 0.02 }, { 'N', 0.02 }, { 'R', 0.02 }, { 'S', 0.02 }, { 'V', 0.02 }, { 'W', 0.02 }, { 'Y', 0.02 }, }; struct amino_acid homo_sapiens[] = { { 'a', 0.3029549426680 }, { 'c', 0.1979883004921 }, { 'g', 0.1975473066391 }, { 't', 0.3015094502008 }, }; static const char alu[] = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG" "GGAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGA" "GACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAA" "AATACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAAT" "CCCAGCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAAC" "CCGGGAGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTG" "CACTCCAGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; int main(int argc, const char **argv) { int n = argc > 1 ? atoi( argv[1] ) : 512; random_t rand; random_init(&rand); repeat(alu, ">ONE Homo sapiens alu\n", n*2); randomize(amino_acid, ARRAY_SIZE(amino_acid), ">TWO IUB ambiguity codes\n", n*3, &rand); randomize(homo_sapiens, ARRAY_SIZE(homo_sapiens), ">THREE Homo sapiens frequency\n", n*5, &rand); return 0; }
Go to most recent revision | Compare with Previous | Blame | View Log